Abstract

Leptospira infection can cause potential hazards to human health by stimulating inflammation, which is mediated mainly through the Toll-like receptor 2 (TLR2) pathway. Gold nanoparticles (AuNPs) are promising for medical applications, as they display both bioinert and noncytotoxic characteristics. AuNPs have been shown to have the ability to modify immune responses. To understand the in vitro immunomodulatory effect of AuNPs in a Leptospira infection model, the activation of TLR2 expression was examined in HEK-Blue-hTLR2 cells treated with Leptospira serovars and/or AuNPs (10 and 20 nm). The ability of AuNPs to modulate an inflammatory response induced by Leptospira was examined in terms of transcript expression level modulation of three proinflammatory cytokines (tumor necrosis factor-α, interleukin (IL)-1β and IL-6) using two-stage quantitative real-time reverse transcriptase PCR. The results revealed that the administration of 10 nm AuNPs could augment the Leptospira-induced TLR2 signaling response and upregulate the expression of all three cytokine gene transcripts, whereas the 20 nm AuNPs attenuated the TLR2 activation and expression of proinflammatory cytokines. This indicates that AuNPs can modulate inflammatory parameters in Leptospira infection and different-sized AuNPs had different immunomodulatory functions in this model.

Highlights

  • Leptospirosis is a zoonotic disease caused by infection of Leptospira bacteria

  • In order to better understand the properties of AuNPs in the regulation of the Toll-like receptor 2 (TLR2)-mediated production of proinflammatory cytokines, a comprehensive study on the effect of AuNPs on Leptospira-induced cytokines production through a TLR2-mediated pathway was performed in this study

  • HEK-Blue-hTLR2 cells were seeded into 24-well plates at a density of 105 cells/well in 500 μL of complete medium (CM) and incubated at 37 ◦C under a 5% (v/v) CO2 atmosphere overnight

Read more

Summary

Introduction

Leptospirosis is a zoonotic disease caused by infection of Leptospira bacteria. Depending on the Leptospira serovar and amount of bacterial infection, clinical manifestations can vary with the infected person. The innate immune system responds to Leptospira infection through an inflammatory response as well as the production of cytokines. A previous study revealed that the increased level of inflammatory cytokines and chemokines in response to Leptospira infection in humans was mediated mainly through the TLR2 pathway, rather than through the TLR4 pathway [8]. Regulation of TLR2 responses in Leptospira-infected humans could potentially offer great promise for the control of inflammation. AuNPs are used in clinical diagnostic tests for different diseases, including leptospirosis, and are used for their anti-inflammatory properties [12,13,14]. It is, unknown how AuNPs impact the immune response in leptospirosis. In order to better understand the properties of AuNPs in the regulation of the TLR2-mediated production of proinflammatory cytokines, a comprehensive study on the effect of AuNPs on Leptospira-induced cytokines production through a TLR2-mediated pathway was performed in this study

Characterization of AuNPs
Cell Culture
Activation of TLR
F: TGCAGAAAAAGGCAAA R: CAACAACAATCTGAGGTG F: GGCCAGCAAATTACCTGTGTG R
Cell Morphology and Viability Assay
Findings
Conclusions

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.