Abstract
Autoregulation is one of the mechanisms of imparting feedback control on gene expression. Positive autoregulatory feedback results in induction of a gene, and negative feedback leads to its suppression. Here, we report an interesting mechanism of autoregulation operating on Drosophila Rel gene dorsal that can activate as well as repress its expression. Using biochemical and genetic approaches, we show that upon immune challenge Dorsal regulates its activation as well as repression by dynamically binding to two different kappaB motifs, kappaB(I) (intronic kappaB) and kappaB(P) (promoter kappaB), present in the dorsal gene. Although the kappaB(I) motif functions as an enhancer, the kappaB(P) motif acts as a transcriptional repressor. Interestingly, Dorsal binding to these two motifs is dynamic; immediately upon immune challenge, Dorsal binds to the kappaB(I) leading to auto-activation, whereas at the terminal phase of the immune response, it is removed from the kappaB(I) and repositioned at the kappaB(P), resulting in its repression. Furthermore, we show that repression of Dorsal as well as its binding to the kappaB(P) depends on the transcription factor AP1. Depletion of AP1 by RNA interference resulted in constitutive expression of Dorsal. In conclusion, this study suggests that during acute phase response dorsal is regulated by following two subcircuits: (i) Dl-kappaB(I) for activation and (ii) Dl-AP1-kappaB(P) for repression. These two subcircuits are temporally delineated and bring about overall regulation of dorsal during immune response. These results suggest the presence of a previously unknown mechanism of Dorsal autoregulation in immune-challenged Drosophila.
Highlights
□S The on-line version of this article contains supplemental Information 1 and 2 and Fig. 1
In Drosophila, activation of Toll upon microbial infection involves the recruitment of the adaptor protein Myd88, leading to the activation of the kinase Pelle and subsequent phosphorylation and degradation of Cactus, the cytoplasmic inhibitor of Dorsal and Dif, which brings about rapid nuclear translocation of these two transcription factors [17, 18]
The following primers were used for Chromatin Immunoprecipitation (ChIP) assay: primers used for amplifying BI motif, forward primer CAAAGAAAATGGAGGGCAGA and the reverse primer AAGAGAGAGTGGGCAAAGAGC
Summary
Drosophila Stocks—w1118 flies were used as standard wild type strain. dl flies were obtained from Bloomington Stock Centre. The labeled DNA was purified, and binding reaction was performed for 45 min at room temperature by mixing 1 ng of purified 32P-labeled doublestranded synthetic oligonucleotide probe (4000 cpm/l), 10 l of nuclear extracts, and 300 ng of poly(dI-dC) in the presence of a protease inhibitor mixture (Sigma). Coupled in Vitro Transcription and Translation—Different luciferase constructs (1 g each) were used for coupled in vitro transcription and translation These plasmids were incubated with cell extracts prepared from LPS- and PGN-treated S2 cells. The following primers were used for ChIP assay: primers used for amplifying BI motif, forward primer CAAAGAAAATGGAGGGCAGA and the reverse primer AAGAGAGAGTGGGCAAAGAGC This primer pair amplifies 177-bp PCR product. Both primer sets were standardized to amplify at Tm 62 °C and were used in multiplex PCR
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
