Abstract

Background: miRNAs are single-stranded, small RNA molecules with a length of 18–25 nucleotides. They bind to the 3′ untranslated regions of mRNA transcripts to reduce the translation of these transcripts or to cause their degradation. The roles of these molecules differ in biological processes, such as cell differentiation, proliferation, apoptosis and tumor genesis. miRNA-33 is encoded by the gene introns of proteins that bind sterol-regulatory elements. This molecule cooperates with these proteins to control cholesterol homeostasis, fatty acid levels and the genes that are related to the expression of fat metabolism. The examination of miR-33 expression and its target genes can promote the in-depth study of the miRNA regulation mechanism in the formation process of goose fatty liver and can lay a foundation for research into human fatty liver. Methodology/principal findings: (1) Through real-time fluorescent quantitative polymerase chain reaction (TaqMan MicroRNA Assay), we detected the expression of miR-33 during the feeding of Landes geese. The expression level of miR-33 increases significantly in the liver after 19 days in comparison with the control group; (2) By using the bioinformatics software programs TargetScan, miRDB and miRCosm to predict the target genes of miR-33 according to laboratory prophase transcriptome results and references, we screen nine target genes: adenosine triphosphate binding cassette transporters A1, adenosine triphosphate binding cassette transporters G1, Neimann Pick C, carnitine O-octanoyltransferase (CROT), cyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase, beta subunit (HADHB), AMP-activated protein kinase, alpha subunit 1 (AMPKα1), insulin receptor substrate 2, glutamic pyruvate transaminase and adipose differentiation-related protein. The dual luciferase reporter gene system in the CHO cell line verifies that CROT, HADHB and NPC1 are the target genes of miR-33 in geese. The inhibition rate of CROT is highest and reaches 70%; (3) The seed sequence (5′ 2–8 bases) is the acting site of miR-33. The two predicted target sites of CROT are the target sites of miR-33. Moreover, the predicted target site of HADHB and NPC1 is the target site of miR-33. Conclusions/significance: (1) After 19 days of overfeeding, the expression level of miR-33 increases significantly in the livers of geese; (2) CROT, HADHB and NPC1 are the target genes of miR-33 in geese. These genes determine the combined target site.

Highlights

  • MiRNA is an important control factor in gene expression

  • Nine target genes were selected for further validation (Figure 3): Adenosine triphosphate binding cassette transporters A1 (ABCA1), adenosine triphosphate binding cassette transporters G1 (ABCG1), Neimann Pick C (NPC1), carnitine O-octanoyltransferase (CROT), HADHB, AMPKα1, insulin receptor substrate 2 (IRS2), glutamic pyruvate transaminase (GPT2) and adipose differentiation-related protein (ADRP)

  • The liver is a vital organ that plays an important role in lipid metabolism, digestion, absorption, synthesis, decomposition and transport

Read more

Summary

Introduction

MiRNA is an important control factor in gene expression. Its roles differ in biological processes, such as cell differentiation, proliferation, apoptosis and tumor genesis [1]. In the gene intron of the sterol-regulatory element binding protein (SREBP) in fruit flies, mice, chickens, humans and other species, the highly conserved miRNA family miR-33 cooperates with these proteins to form a negative feedback loop. This collaboration controls cholesterol homeostasis, fatty acid level and the expression of fat metabolism-related genes [3,4,5,6]. Adenosine triphosphate binding cassette transporters A1 (ABCA1) are a type of membrane-binding protein and a type of cholesterol transporter that can cause excess cholesterol to become extracellular This process is important in the cholesterol homeostasis of the cells of the entire body. The study on the regulation of miR-33 expression in geese is significant to livestock production and to the treatment of fatty liver disease in humans

Precursor Sequence of the miRNA-33 of Landes Geese
Prediction of miR-33 Target Genes
Amplification of the Target Sequence and Vector Construction
Verification of miR-33 Target Gene
Verification of the miR-33 Target Site
Analysis of miRNA-33 Expression in the Fatty Liver of Geese
Prediction of the miRNA-33 Target Gene in Landes Geese
Verification of the miRNA-33 Target Gene
Verification of the miRNA-33 Target Site
Experimental Animals and Breeding Management
Prediction of Target Genes
Primers of Carrier Construction
F AGTGCATTGTAGTTGCGCAACATGTGACGG
Vector Construction
Point Mutation
Dual-Luciferase Reporter Assay
CHO Culture and Transfection
Conclusions
Full Text
Paper version not known

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.