Detection of Listeria monocytogenes from Raw Milk (Nono) in Cows Using Polymerase Chain Reaction.

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 μL and 50 μL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.

Listeria monocytogenes is a gram-positive food-borne pathogen that causes listeriosis in humans. Currently, there is little information on the prevalence of Listeria monocytogenes in raw milk and traditional yoghurt-like milk beverage, nunu, in Ghana. The purpose of this study was to investigate the prevalence of L. monocytogenes isolates in raw cow milk, boiled milk and nunu in Ghana, and to characterize these L. monocytogenes isolates according to their serogroups, virulence potentials and antibiotic susceptibility profiles. A total of 254 samples comprising 114 raw cow milk, 56 boiled milk and 84 nunu were collected from dairy farms and market vendors for detection of L. monocytogenes. The overall prevalence of L. monocytogenes in raw milk, boiled milk and nunu was 5.5% (14/254). Listeria monocytogenes was prevalent in raw cow milk (8.8%; 10/114) and nunu (13.1%; 11/84), while no Listeria spp. was not detected in boiled milk. A total of 62 L. monocytogenes isolates were analysed to belong to molecular serogroups 1/2a-3a (32/62, 51.6%), 1/2b-3b-7 (14/62, 22.6%), 4b-4d-4e (9/62, 14.5%) and 1/2c-3c (7/62, 11.3%). All 62 L. monocytogenes isolates harbored the virulence-associated genes inlA, inlB, inlC, inlJ, plcA, actA, hlyA, iap and prfA. All Listeria monocytogenes in the present study were generally susceptible to the tested antibiotics, except neomycin and tetracycline, for which phenotypic resistance was observed among isolates.

Listeria monocytogenes in raw milk, milking equipment and dairy workers: Molecular characterization and antimicrobial resistance patterns.

Prevalence, characterisation, and antimicrobial resistance of Listeria species and Listeria monocytogenes isolates from raw milk in farm bulk tanks

Kinetic and proteomic studies in milk show distinct patterns among major Listeria monocytogenes clones

Listeria (L.) monocytogenes is an ‘emerging food borne pathogen’ that poses threat to global food safety. Its occurrence in milk and milk products constitute a negative impact to the dairy industry. Despite its veterinary public health significance, only few studies are available on the prevalence and characteristics of the organism from milk and milk products in Nigeria. The main objectives of this study were to isolate, identify and determine the antibiotic susceptibility patterns of the Listeria monocytogenes isolated from raw milk and milk product in Kaduna state Nigeria. A total of 550 samples of raw milk and milk products (fermented milk “Kindrimo” and milk butter “Manshanu”) were collected during a cross-sectional study. Of these 550 samples, 193 (35.10%) samples were positive for Listeria species- like growth when plated on chromogenic Listeria agar, 91 (47.15%) from raw milk, 65 (33.67%) from ‘Manshanu’ and 37 (19.15%) ‘Kindrimo’. A total of 36 (6.55%) were found to be L. monocytogenes based on conventional biochemical tests. However, when further subjected to MicrobactTM Listeria 12L detection Kit (Oxoid, MB1128A) only 3 (8.3%) of the 36 isolates were identified as L. monocytogenes, while the others were L. grayi 4 (11.1%), L. ivanovii 27 (75.0%) and L. seeligeri 2 (5.6%). The multiplex PCR assay identified 9 Listeria (L.) monocytogenes isolates harbouring the hly A gene. The susceptibility of 36 L. monocytogenes isolates to 10 antibiotics was evaluated using the disk diffusion method. Isolates from milk samples had an overall resistance of 64.09% to the antibiotics, followed by isolates from ‘Kindrimo’ (61.67%), and least resistance was observed in isolates from ‘Manshanu” (58.33%). Overall, L. monocytogenes isolates showed the highest frequency of resistance to ampicillin (100%), followed by penicillin (95%) and cloxacillin (90%). In conclusion, the isolation of L. monocytogenes and other Listeria species in this study calls for an improved hygienic practices in the milk and milk products production channels and for the enlightment of the Fulani herds men and women by agricultural extension workers. Also, the resistance pattern shown by the isolates is an indication that the use of antibiotics should be regulated to minimize the incidence of antibiotic resistance.

The objectives of study were to assess presence of Listeria monocytogenes, perform serotyping and investigate antibiotic resistance in raw milk and dairy products. A total of 210 milk and dairy products including white (n = 20) and kashar cheese (n = 20), ice cream (n = 20), butter (n = 20), cokelek (n = 10), kuymak (n = 10) and farm cheese (n = 10) were obtained from Samsun, Turkey. All samples were analyzed using an immunomagnetic separation‐based culture technique and strains of L. monocytogenes were confirmed by presence of hlyA and iap genes by polymerase chain reaction (PCR). L. monocytogenes was identified in 5 of 100 (5%) milk samples, serotyped as 4b and 1/2b, and in 9 of 110 (8.2%) dairy products, serotyped as 1/2a, 1/2b and 1/2c. However, L. monocytogenes was not identified from butter, kashar and ice cream samples. The antibiotic susceptibility against ampicillin, amoxicillin/clavulanic acid, erythromycin, chloramphenicol, penicillin G, oxytetracycline, tetracycline and vancomycin was assessed by disc diffusion method. It was found that 15.3% of isolates were resistant to at least one drug and 36.5% were multidrug resistant. Among isolates, resistance to tetracycline was most commonly encountered (34.6%), followed by resistance to chloramphenicol (25%) and penicillin G (23%). In conclusion, our data also indicate that consuming raw and unpasteurised milk and dairy products could pose a risk of listeriosis in humans.Practical ApplicationsAlthough there are plenty of studies about the incidence of L. monocytogenes in raw milk and dairy products in Turkey, our study is the first one in Samsun (Middle Black Sea) Region about Listeria in milk and dairy products. Also in our study, we characterized some virulence genes and serotype distribution of L. monocytogenes by PCR. Finally, we performed antibiotic resistance tests of isolates to see possible public health threats because of using overabundant antibiotics. If we analyze all these work to see the potential risk assessments in this region, our study could be a leading study in near future.

Food safety remains the main health concern in the developing countries. Thus, the major purpose of the present study was to characterize and determine antibiotic susceptibility patterns of Listeria monocytogenes from raw milk samples collected from southern Ethiopia. Two hundred and forty raw cow milk samples were collected from dairy farms and smallholder dairy producers using a simple random sampling technique and analyzed by cultural and multiplex PCR methods. The antimicrobial susceptibility profile of L. monocytogenes was evaluated using the standard disk diffusion method. Over 28% of the samples were found positive for Listeria spp., of which 17 (7.08%) isolates were identified as L. monocytogenes after morphological and biochemical confirmation. The prevalence of L. monocytogenes was 6.02% in Hawassa city, 5.56% in Dale district, and 9.41% in Arsi Negele district. L. monocytogenes was higher in the wet season (9.32%) than in the dry season (4.92%). The gene for Listeria specific 16S rRNA was detected in all the 17 examined isolates, while hlyA and iapA were only found in 11 of them. Furthermore, no isolate was identified to have the prfA, actA, or plcA genes. Antimicrobial resistance profiling revealed that all the L. monocytogenes isolates were resistant to nalidixic acid (100%), followed by erythromycin (88.24%). However, all the L. monocytogenes isolates were sensitive to vancomycin, gentamicin, and sulfamethoxazole. Raw cow milk is a potential source of L. monocytogenes and it poses a threat to human and animal health. Therefore, it is crucial that dairy producers and vendors of raw milk in the study areas should take considerable precautions to prevent Listeria species from contaminating raw fresh milk.

Listeria monocytogenes (L. monocytogenes) is a foodborne pathogen that poses significant risks to public health and food safety. The present study aimed to identify the presence of Listeria spp. in various samples, including pasteurized milk, chicken fillets, and stool samples from pregnant women in Sharkia Governorate, Egypt. Additionally, the study identified the serotypes, virulence-associated genes, antimicrobial resistance patterns, and biofilm formation in L. monocytogenes isolates. Moreover, the antibacterial and anti-biofilm activity of Lactobacillus plantarum ATCC 14917 (L. plantarum) against L. monocytogenes isolates was investigated. A cross-sectional study was conducted from August 2021 to January 2022 to collect 300 samples of pasteurized milk, chicken fillets, and stool from pregnant women admitted to outpatient clinics of hospitals. The results showed that 32.7% of the samples were positive for Listeria spp., including L. innocua (48.9%), L. monocytogenes (26.5%), L. ivanovii (14.3%), L. grayi (5.1%), and L. welshimeri (5.1%). Among all L. monocytogenes isolates, hlyA, actA, inlC, and inlJ virulence-associated genes were detected. However, the virulence genes plcB, iap, and inlA were found in 10 (38.5%), 8 (30.8%), and 25 (96.2%) isolates, respectively. The L. monocytogenes isolates classified into four serotypes (1/2a, 1/2b, 1/2c, and 4b), with 1/2a and 4b each identified in 30.8% of the isolates, while 1/2b and 1/2c were identified in 19.2% of the isolates. All L. monocytogenes isolates showed 100% resistance to streptomycin, kanamycin, and nalidix acid, and 92.3% of isolates showed gentamicin resistance. However, all isolates were susceptible to ampicillin and ampicillin/sulbactam. Multidrug resistance (MDR) was observed in 20 (76.9%) L. monocytogenes isolates. The biofilm formation ability of 26 L. monocytogenes isolates was evaluated at different incubation temperatures. At 4°C, 25°C, and 37°C, 53.8, 69.2, and 80.8% of the isolates, respectively, were biofilm producers. Furthermore, 23.1% were strong biofilm producers at both 4°C and 25°C, while 34.6% were strong biofilm formers at 37°C. Treating L. monocytogenes isolates with L. plantarum cell-free supernatant (CFS) reduced the number of biofilm-producing isolates to 15.4, 42.3, and 53.8% at 4°C, 25°C, and 37°C, respectively. L. plantarum's CFS antibacterial activity was tested against six virulent, MDR, and biofilm-forming L. monocytogenes isolates. At a concentration of 5 μg/mL of L. plantarum CFS, none of the L. monocytogenes isolates exhibited an inhibition zone. However, an inhibition zone was observed against L. monocytogenes strains isolated from pasteurized milk and pregnant women's stools when using a concentration of 10 μg/mL. Transmission electron microscopy (TEM) revealed that L. plantarum CFS induced morphological and intracellular structural changes in L. monocytogenes. In conclusion, this study identified virulent MDR L. monocytogenes isolates with strong biofilm-forming abilities in food products in Egypt, posing significant risks to food safety. Monitoring the prevalence and antimicrobial resistance profile of L. monocytogenes in dairy and meat products is crucial to enhance their safety. Although L. plantarum CFS showed potential antibacterial and anti-biofilm effects against L. monocytogenes isolates, further research is needed to explore its full probiotic potential.

Considering the possible incidence of Listeria monocytogenes in raw foods and their pathogenicity and health risk, this study aimed to compare techniques for extraction of bacterial DNA from milk samples and investigate the presence of L. monocytogenes by Polymerase Chain Reaction (PCR) in raw milk. We tested four different extraction protocols (generally identified: A, B, C, and D) for isolation of bacterial DNA directly from milk. In all of them was obtained identifying the product of 702 bp (base pairs) corresponding to the listeriolysin gene from L. monocytogenes. The protocol B containing proteinase K and phenol buffered, was chosen for the extraction of DNA from milk samples from eight dairy farms within the RS. The subsequent PCR amplification with DNA obtained by the protocol B allowed the identification of L. monocytogenes from 103 CFU/mL. None of the samples was positive for the producer L. monocytogenes by PCR or by conventional microbiological analysis. With this study it is concluded that the tested protocols, the protocol B was more effective for the detection of L. monocytogenes by PCR. Moreover, for the samples of the producers, the result PCR technique was obtained in a shorter time than conventional analysis of L. monocytogenes, which may allow earlier treatment of infected animals and thus avoid losses to the producer.

Antimicrobial resistance (AMR) is a growing global concern and poses a significant threat to public health. The emergence of multidrug-resistant organisms, including Escherichia coli, also presents a risk of transmission to humans through the food chain, including milk. This study aimed to investigate the prevalence of E. coli in raw milk in the Chattogram metropolitan area (CMA) of Bangladesh and their phenotypic and genotypic antimicrobial resistance patterns. A total of 450 raw cow milk samples were collected from 18 farms within the CMA. The isolation and identification of E. coli were performed following standard bacteriological methods. Antimicrobial susceptibility testing (AST) was conducted using the Kirby-Bauer disc diffusion method. Molecular detection of E. coli and antimicrobial resistance genes was performed using the Polymerase Chain Reaction (PCR). This study found 134 (29.77%) milk samples that tested positive for E. coli. Antimicrobial susceptibility testing (AST) revealed the highest resistance rates (69.40%) to be for ampicillin, amoxicillin-clavulanic acid, cephalothin, and cephalexin, with the lowest resistance (21.64%) being for norfloxacin. A significant correlation (r = 1) was observed between ciprofloxacin and ceftazidime resistance among the antimicrobials tested. All E. coli isolates were classified as multidrug-resistant (MDR), being resistant to three or more antimicrobial classes, with a multiple resistance index >0.2. PCR amplification showed that the blaTEM gene had the highest prevalence (74.19%) among the ESBL and antimicrobial resistance genes tested. In contrast, the blaCMY-1 gene had a lower prevalence (6.45%) among the ESBL genes, while the tetD gene had the lowest prevalence (2.9%) among the resistance genes tested. Positive correlations were observed between antimicrobial resistance and the presence of these resistance genes. This study emphasises the high prevalence of MDR E. coli in raw cow milk and its significant potential impact on public health. It underscores the urgent need for strategic interventions to effectively manage and mitigate AMR in the Bangladeshi dairy sector, focusing on the prudent use of antimicrobials and implementing enhanced AMR surveillance.

Food borne diseases encompass a wide array of illnesses and are a growing public health hazard worldwide. Listeria monocytogenes causes food borne listeriosis, which is a relatively rare but serious emerging disease with high fatality rates among susceptible population. This study was conducted to detect the presence of L. monocytogenes from milk and milk products in Puducherry. A total of 200 samples including 100 raw milk, 50 pasteurized milk and 50 ice cream samples were collected from different retail shops in Puducherry. Results revealed 4 samples (4%) from raw milk and 1 sample (2%) from ice cream were suspected for L. monocytogenes. All the suspected isolates were confirmed as L. monocytogenes by various cultural and morphological examination. Also, all were positive for hlyA gene by polymerase chain reaction which is confirmative for L. monocytogenes. Further biofilm production assay revealed two isolates from raw milk were moderate biofilm producers (40%) and three isolates which included two from raw milk and one from ice cream were weak biofilm producers (60%). Antibiotic resistance profiling of the isolates showed an increased resistance to gentamicin, vancomycin and penicillin G which are commonly used in the treatment of listerial infection. This study directs the need for proper hygienic measures before and after collection of milk, processing and proper storage of milk and dairy products to limit the contamination level.

This study was aimed to investigate the presence of Listeria monocytogenes in raw water buffalo milk and milk products, besides determining its serotype and the extent of its resistance against various antibiotics. A total of 188 samples of raw water buffalo milk and milk products were collected from Samsun Province, Turkey between November 2012 and May 2013. The classical culture technique was used to isolate and identify L. monocytogenes, as described in EN ISO 11290-1. The isolates were confirmed as L. monocytogenes by using PCR with (hylA) primers specific for the hemolysin gene. The antimicrobial susceptibility test was achieved by using the VITEK 2 compact system and VITEK 2 AST-P640 card. L. monocytogenes was found in 7 (3.7%) of the 188 samples. Four of them were obtained from cheese and three from milk samples. Whereas, L. monocytogenes was not detected in any of the clotted cream samples. A total of 13 isolates were confirmed by PCR as L. monocytogenes. Among these isolates, one was 1/2c (or 3c) (7.6%), three were 4b (or 4d, 4e) (23%), four were 1/2b (or 3b) (30.7%), and the other five isolates were serotype 1/2a (or 3a) (38.4%). The highest antimicrobial resistance was recorded against fosfomycine (100%) followed by oxacillin (92%), penicillin (84%), and erythromycin (69%). However, no resistance was determined against ciprofloxacin, gentamicin, and tigecycline. PRACTICAL APPLICATION: This study showed that some samples of raw buffalo milk and the milk products were contaminated with Listeria monocytogenes. The serotype with the highest prevalence was determined as L. monocytogenes 1/2a. This study also demonstrated that most of the L. monocytogenes isolates had developed multiresistance to many frequently used medical antimicrobial agents.

BackgroundLack of clear risk factor identification is the main reason for the persistence of brucellosis infection in the Chinese population, and there has been little assessment of the factors contributing to Brucella contamination of raw whole milk. The purpose of this study was to identify risk factors affecting Brucella contamination of raw milk, and to evaluate effective measures for disease reduction in order to determine preventive strategies.Methods and FindingsA nationwide survey was conducted and samples were obtained from 5211 cows corresponding to 25 sampling locations throughout 15 provinces in China. The prevalence of Brucella in the raw milk samples averaged 1.07% over the 15 Chinese provinces, while the prevalence of positive areas within these regions ranged from 0.23–3.84% among the nine provinces with positive samples. The survey examined factors that supposedly influence Brucella contamination of raw whole milk, such as management style, herd size, abortion rate, hygiene and disease control practices. A binary logistic regression analysis was carried out to determine the association between risk factors for Brucella and contamination of milk samples. Furthermore, a relative effect decomposition study was conducted to determine effective strategies for reducing the risk of Brucella contamination of raw whole milk. Our data indicate that disease prevention and control measures, abortion rate, and animal polyculture are the most important risk factors. Meanwhile, culling after quarantine was identified as an effective protective measure in the current Chinese dairy situation.ConclusionsThese results indicate that, although there is a low risk of contamination of milk with Brucella nationwide in China, there are individual regions where contamination is a significant problem. Controlling three factors–culling after quarantine, maintaining a low abortion rate, and avoiding mixing groups of cattle and small ruminants–could effectively reduce the risk of Brucella contamination of raw whole milk.

Listeria monocytogenes as one of the most important pathogen in public health concerns is transmitted through consumption of contaminated food. The pathogen has been considered as a potential source of contamination of raw milk and dairy products. This research was aimed to investigate prevalence of L. monocytogenes in raw milk in Kerman region. In the summer of 2011, a total number of one hundred raw milk samples were collected from bulk tanks of some dairy farms and tested for iap and actA genes using polymerase chain reaction. Among the 100 samples, five isolates (5.0%) were detected as L. monocytogenes based on phenotypic and genotypic characteristics. Considering the low frequency of L. monocytogenes in this study, raw milk cannot be omitted as a potential source of food contamination for the population of the region. To achieve more accurate isolation, identification and control of L. monocytogenes in raw milk, it is suggested that new standard laboratory methods be implemented as well as biosafety outreach programs, management techniques and education.