Abstract
A minimally invasive diagnostic assay for early detection of Alzheimer's disease (AD) is required to select optimal patient groups in clinical trials, monitor disease progression and response to treatment, and to better plan patient clinical care. Blood is an attractive source for biomarkers due to minimal discomfort to the patient, encouraging greater compliance in clinical trials and frequent testing. MiRNAs belong to the class of non-coding regulatory RNA molecules of ∼22 nt length and are now recognized to regulate ∼60% of all known genes through post-transcriptional gene silencing (RNAi). They have potential as useful biomarkers for clinical use because of their stability and ease of detection in many tissues, especially blood. Circulating profiles of miRNAs have been shown to discriminate different tumor types, indicate staging and progression of the disease and to be useful as prognostic markers. Recently their role in neurodegenerative diseases, both as diagnostic biomarkers as well as explaining basic disease etiology has come into focus. Here we report the discovery and validation of a unique circulating 7-miRNA signature (hsa-let-7d-5p, hsa-let-7g-5p, hsa-miR-15b-5p, hsa-miR-142-3p, hsa-miR-191-5p, hsa-miR-301a-3p and hsa-miR-545-3p) in plasma, which could distinguish AD patients from normal controls (NC) with >95% accuracy (AUC of 0.953). There was a >2 fold difference for all signature miRNAs between the AD and NC samples, with p-values<0.05. Pathway analysis, taking into account enriched target mRNAs for these signature miRNAs was also carried out, suggesting that the disturbance of multiple enzymatic pathways including lipid metabolism could play a role in AD etiology.
Highlights
Alzheimer’s disease (AD) is a progressive neurodegenerative disease manifested by dementia typically observed in the elderly
Amyloid plaques result from abnormal levels of extracellular amyloid beta (Ab) peptide, which are products of sequential enzymatic cleavages of ß-amyloid precursor protein (APP) by ß- secretase (BACE1) and csecretase
1 mL of human plasma was added to an equal amount of 26 denaturing buffer and spiked with 10 ml of 0.05 mM synthetic Ath-159a (Table S3 in File SI) and 40 pM of NegA (UUGUGGCGAGCGGAAUGGAAU)
Summary
Alzheimer’s disease (AD) is a progressive neurodegenerative disease manifested by dementia typically observed in the elderly. Loss of memory, visual-spatial skills, and psychiatric symptoms. 24 million people worldwide have dementia, of which the majority (,60%) is due to AD [1]. The neuropathology of AD is characterized by the presence of amyloid plaques, neurofibrillary tangles, synaptic loss and selective neuronal cell death in the brain [2]. Amyloid plaques result from abnormal levels of extracellular amyloid beta (Ab) peptide, which are products of sequential enzymatic cleavages of ß-amyloid precursor protein (APP) by ß- secretase (BACE1) and csecretase. Neurofibrillary tangles on the other hand are associated with the presence of intracellular hyper-phosphorylated tau protein. Compared with normal tau, which contains two to three phosphate groups, the p-tau contains 5–9 phosphate groups per protein and inhibits the normal tau-promoted microtubule assembly [3]
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
