Aster yellows integrated management in Western Canada and the United States Upper Midwest

Camelina (Camelina sativa L.) is an oilseed crop in the Brassicaceae family that can be grown as a spring or summer annual or as a biennial winter crop in a variety of climates and soil conditions (Moser 2010). It has been grown on a commercial basis in Montana for more than a decade (Grady and Nleya 2010). During the 2020 and 2021 growing seasons, camelina plants grown in plots at Sidney, MT, exhibited symptoms typical of aster yellows phytoplasma (Candidatus Phytoplasma asteris) infection. Symptoms included stunted growth, purpling of leaves, phyllody, proliferation of shoots and axillary shoots, and a reduced number or absence of pods (Figure 1). We examined 1696 single plants in a field experiment, approximately 4% in the 0.5-acre plot was found with symptoms. Plants were collected from seven locations across the field, with three replicate plants per location. Two 2-cm pieces of branches were taken from each plant for DNA extraction, using the BioSprint DNA Plant Kit (Qiagen, Germany) following the manufacturer's instructions. DNA was amplified by nested PCR first using the primers P1 (AAGAGTTTGATCCTGGCTCAGGATT) and P6 (TGGTAGGGATACCTTGTTACGACTTA), then R16F2 (ACGACTGCTGCTAAGACTGG) and R16R2 (TGACGGGCGGTGTGTACAAACCCCG), according to the protocol described by Olivier et al. (2010). These primers are universal for phytoplasma detection, which amplify a specific 16S rDNA fragment. PCR products of 1200 bp were obtained from all symptomatic plants, while no amplicons were obtained from the asymptomatic plants, including the asymptomatic parts of the partially infected plant. The PCR products were sequenced with primers R16F2 and R16R2 from both 5' and 3' ends, and the resulting sequences were submitted to GenBank (accession no. PQ134480). BLASTN search showed that the sequences we obtained were 99.46% similar to Maryland aster yellows phytoplasma (accession no. KC283215) and Sesame phyllody phytoplasma (accession no. JX448399, JX448400, JX448401, HM449958). To further confirm the identity of the pathogen, a second set of primers fTuf1 (CACATTGACCACGGTAAAAC) and rTuf1 (CCACCTTCACGAATAGAGAAC) were used (Schneider et al. 1997). These primers universally amplify phytoplasma elongation factor TU (tuf) gene fragment. PCR products around 1100 bp were obtained, sequenced with the same primers, and submitted to GenBank (accession no. PQ256823). BLASTN result shows that the sequences were 99.80% identical to aster yellows witches'-broom phytoplasma (accession no. AY277404, CP000061). These sequencing results suggest that the pathogen infecting camelina is aster yellows phytoplasma. Aster yellows has been reported on camelina in South Dakota (Byamukama et al. 2016) and Canada (Séguin-Swartz et al. 2009). Our sequence was 100% similar to the one reported in South Dakota. To our knowledge, this is the first report of aster yellows on camelina in Montana. The phytoplasma has a wide host range, primarily Asteraceae, and is vectored by the aster leafhopper (Macrosteles quadrilineatus). Weeds in the Asteraceae can act as reservoirs for the carryover of the pathogen from year to year. The pathogen can also infect canola, barley, wheat, peas, and alfalfa, which are widely grown as rotation crops in the Sidney, MT area. The aster leafhopper is commonly found on wheat in SD (Varenhorst, 2024). The distribution and impact of aster yellows on camelina productivity in Montana remains to be determined, but this discovery alerts the researchers and growers to be aware of the disease.

This study revealed that feral aster leafhoppers, Macrosteles quadrilineatus Forbes, exposed to aster yellows phytoplasma live longer and may lay more eggs than nonexposed leafhoppers. Aster leafhoppers were reared on asters infected with either of 2 strains of aster yellows phytoplasma or uninfected asters. After eclosion, adults were placed on uninfected healthy lettuce or oat plants and transferred periodically. The life span of test leafhoppers and the number of offspring they produced were compared. Females reared on noninfected aster plants lived for an average of 19 d, those reared on ‘severe’ and ‘bolt’ strain aster yellows phytoplasma-infected plants lived 26 and 28 d, respectively. The mean number of offspring produced by females reared on the bolt strain of aster yellows phytoplasma-infected asters was almost twice the number produced by nonexposed leafhoppers. The life span of feral leafhoppers or the number of eggs laid did not differ for leafhoppers maintained on either oats or lettuce after exposure to aster yellows phytoplasma-infected asters. Female leafhoppers lived twice as long as males. Our results suggest that the aster leafhopper may have had a long association with aster yellows phytoplasma. The longer life and higher fecundity of phytoplasma-infected leafhoppers may influence disease dynamics of aster yellows in lettuce.

The aster yellows phytoplasma (AYp) is transmitted by the aster leafhopper, Macrosteles quadrilineatus Forbes, in a persistent and propagative manner. To study AYp replication and examine the variability of AYp titer in individual aster leafhoppers, we developed a quantitative real-time polymerase chain reaction assay to measure AYp concentration in insect DNA extracts. Absolute quantification of AYp DNA was achieved by comparing the amplification of unknown amounts of an AYp target gene sequence, elongation factor TU (tuf), from whole insect DNA extractions, to the amplification of a dilution series containing known quantities of the tuf gene sequence cloned into a plasmid. The capabilities and limitations of this method were assessed by conducting time course experiments that varied the incubation time of AYp in the aster leafhopper from 0 to 9 d after a 48 h acquisition access period on an AYp-infected plant. Average AYp titer was measured in 107 aster leafhoppers and, expressed as Log10 (copies/insect), ranged from 3.53 (+/- 0.07) to 6.26 (+/- 0.11) occurring at one and 7 d after the acquisition access period. AYp titers per insect and relative to an aster leafhopper chromosomal reference gene, cp6 wingless (cp6), increased approximately 100-fold in insects that acquired the AYp. High quantification cycle values obtained for aster leafhoppers not exposed to an AYp-infected plant were interpreted as background and used to define a limit of detection for the quantitative real-time polymerase chain reaction assay. This method will improve our ability to study biological factors governing AYp replication in the aster leafhopper and determine if AYp titer is associated with frequency of transmission.

Aster Yellows phytoplasma (AYp; ‘Candidatus Phytoplasma asteris’) is an obligate bacterial pathogen that is the causative agent of multiple diseases in herbaceous plants. While this phytoplasma has been examined in depth for its disease characteristics, knowledge about the spatial and temporal dynamics of pathogen spread is lacking. The phytoplasma is found in plant’s phloem and is vectored by leafhoppers (Cicadellidae: Hemiptera), including the aster leafhopper, Macrosteles quadrilineatus Forbes. The aster leafhopper is a migratory insect pest that overwinters in the southern United States, and historical data suggest these insects migrate from southern overwintering locations to northern latitudes annually, transmitting and driving phytoplasma infection rates as they migrate. A more in-depth understanding of the spatial, temporal and genetic determinants of Aster Yellows disease progress will lead to better integrated pest management strategies for Aster Yellows disease control. Carrot, Daucus carota L., plots were established at two planting densities in central Wisconsin and monitored during the 2018 growing season for Aster Yellows disease progression. Symptomatic carrots were sampled and assayed for the presence of the Aster Yellows phytoplasma. Aster Yellows disease progression was determined to be significantly associated with calendar date, crop density, location within the field, and phytoplasma subgroup.

In Wisconsin, vegetable crops are threatened annually by infection of the aster yellows phytoplasma (AYp), the causal agent of aster yellows (AY) disease, vectored by the aster leafhopper, Macrosteles quadrilineatus Forbes. Aster leafhopper abundance and infectivity are influenced by processes operating across different temporal and spatial scales. We applied a multilevel modeling approach to partition variance in multifield, multiyear, pest scouting data sets containing temporal and spatial covariates associated with aster leafhopper abundance and infectivity. Our intent was to evaluate the relative importance of temporal and spatial covariates to infer the relevant scale at which ecological processes are driving AY epidemics and identify periods of elevated risk for AYp spread. The relative amount of aster leafhopper variability among and within years (39%) exceeded estimates of variation among farm locations and fields (7%). Similarly, time covariates explained the largest amount of variation of aster leafhopper infectivity (50%). Leafhopper abundance has been decreasing since 2001 and reached its minimum in 2010. The average seasonal pattern indicated that periods of above average abundance occurred between 11 June and 1 August. Annual infectivity appears to oscillate around an average value of 2% and seasonal periods of above average infectivity occur between 19 May and 15 July. The coincidence of the expected periods of high leafhopper abundance and infectivity increases our knowledge of when the insect moves into susceptible crop fields and when it spreads the pathogen to susceptible crops, representing a seasonal interval during which management of the insect can be focused.

Mean latent period and transmission rate of 2 strains bolt and severe ) of aster yellows photo plasma in nymph and adult aster leafhopper’s, Macrosteles quadrilineatus Forbes, were studied under controlled conditions at 15, 20, 25, and 30. There was a nonlinear relationship between mean latent period and temperature with shorter mean latent periods at higher temperatures (≈20-25 d) than at lower temperatures (≈40-80 d) for both aster yellows phytoplasma strains and both ages of leafhoppers. The proportion of leafhoppers that became vectors was significantly higher for bolt strain when leafhoppers acquired aster yellows phytoplasma as nymphs than as adults. However, there was no difference in the proportion that became vectors of the severe strain by the 2 age groups. Once leafhoppers became inoculative, the rate of transmission remained constant over their life spans when monitored by serial transfers at 48-h intervals. Increases in temperature and access time of leafhoppers increased tile proportion of leafhoppers that became vectors after feeding on bolt strain-infected plants. Also, the effect of aster yellows phytoplasma exposure on life spans of leafhoppers was studied at 4 temperatures. At 25 and 30, leafhoppers exposed to both aster yellows phytoplasma strains lived longer than those leafhoppers not exposed. Data can be used in an aster yellows epidemiological model to evaluate strategies for aster yellows management.

In plant-microbe-insect systems, plant-mediated responses involve the regulation and interactions of plant defense signaling pathways of phytohormones jasmonic acid (JA), ethylene (ET), and salicylic acid (SA). Phytoplasma subgroup 16SrI is the causal agent of Aster Yellows (AY) disease and is primarily transmitted by populations of aster leafhoppers (Macrosteles quadrilineatus Forbes). Aster Yellows infection in plants is associated with the downregulation of the JA pathway and increased leafhopper oviposition. The extent to which the presence of intact phytohormone-mediated defensive pathways regulates aster leafhopper behavioral responses, such as oviposition or settling preferences, remains unknown. We conducted no-choice and two-choice bioassays using a selection of Arabidopsis thaliana lines that vary in their defense pathways and repeated the experiments using AY-infected aster leafhoppers to evaluate possible differences associated with phytoplasma infection. While nymphal development was similar among the different lines and groups of AY-uninfected and AY-infected insects, the number of offspring and individual female egg load of AY-uninfected and AY-infected insects differed in lines with mutated components of the JA and SA signaling pathways. In most cases, AY-uninfected insects preferred to settle on wild-type (WT) plants over mutant lines; no clear pattern was observed in the settling preference of AY-infected insects. These findings support previous observations in other plant pathosystems and suggest that plant signaling pathways and infection with a plant pathogen can affect insect behavioral responses in more than one manner. Potential differences with previous work on AY could be related to the specific subgroup of phytoplasma involved in each case.

Aster yellows phytoplasma (Candidatus Phytoplasma asteris) is a multi-host plant pathogen and is transmitted by at least 24 leafhopper species. Pathogen management is complex and requires a thorough understanding of vector dynamics. In the American Midwest, aster yellows is of great concern for vegetable farmers who focus on controlling one vector, Macrosteles quadrilineatus—the aster leafhopper. However, vegetable-associated leafhopper communities can be diverse. To investigate whether additional species are important aster yellows vectors, we surveyed leafhopper communities at commercial celery and carrot farms in Michigan from 2018 to 2019 and conducted real-time PCR to determine infection status. Leafhoppers were collected within crop fields and field edges and identified with DNA barcoding. Overall, we collected 5049 leafhoppers, with the most abundant species being M. quadrilineatus (57%) and Empoasca fabae—the potato leafhopper (23%). Our results revealed the most abundant aster yellows vector in Michigan in both crops is M. quadrilineatus, but we also found that E. fabae may be a potential vector for this pathogen. While several taxa reside in and near these crops, we did not find strong evidence that they contribute to phytoplasma infection. These findings indicate that M. quadrilineatus should be the primary target for controlling this pathogen.

Some plant pathogens are capable of manipulating their insect vectors and plant hosts in a way that disease transmission is enhanced. Aster leafhopper (Macrosteles quadrilineatus Forbes) (Hemiptera: Cicadellidae) is the main vector of Aster Yellows Phytoplasma (Candidatus Phytoplasma asteris) in the Canadian Prairies, which causes Aster Yellows (AY) disease in over 300 plant species including cereals and oilseeds. However, little is known about the host range of Aster leafhoppers or their host-choice selection behavior in this geographical region. Several crop and noncrop species commonly found in the Canadian Prairies were evaluated as food and reproductive hosts for Aster leafhoppers through no-choice bioassays. To study possible effects of pathogen infection, AY-uninfected and AY-infected insects were used. Cereals and some noncrops like fleabane were suitable reproductive hosts for Aster leafhoppers, with numbers of offspring observed in treatments using both AY-uninfected and AY-infected insects, suggesting an egg-laying preference on these plant species. Development was similar across the different plant species, except for canola and sowthistle, where growth indexes were lower. Sex-ratios of Aster leafhopper adults did not differ among the plant species or with respect to AY infection. Potential fecundity differed across plant species and was affected by the infection status of the insect. These findings have implications for AY epidemiology and suggest that while cereals can be suitable host plants for Aster leafhopper oviposition and development, some noncrop species could act as alternate hosts for leafhoppers that migrate into the Canadian Prairies before emergence of cereal and canola crops.

Monitoring phytoplasma in populations of aster leafhoppers from lettuce fields using the polymerase chain reaction

In Wisconsin, vegetable crops are threatened annually by the aster yellows phytoplasma (AYp), which is obligately transmitted by the aster leafhopper. Using a multiyear, multilocation data set, seasonal patterns of leafhopper abundance and infectivity were modeled. A seasonal aster yellows index (AYI) was deduced from the model abundance and infectivity predictions to represent the expected seasonal risk of pathogen transmission by infectious aster leafhoppers. The primary goal of this study was to identify periods of time during the growing season when crop protection practices could be targeted to reduce the risk of AYp spread. Based on abundance and infectivity, the annual exposure of the carrot crop to infectious leafhoppers varied by 16- and 70-fold, respectively. Together, this corresponded to an estimated 1,000-fold difference in exposure to infectious leafhoppers. Within a season, exposure of the crop to infectious aster leafhoppers (Macrosteles quadrilineatus Forbes), varied threefold because of abundance and ninefold because of infectivity. Periods of above average aster leafhopper abundance occurred between 11 June and 2 August and above average infectivity occurred between 27 May and 13 July. A more comprehensive description of the temporal trends of aster leafhopper abundance and infectivity provides new information defining when the aster leafhopper moves into susceptible crop fields and when they transmit the pathogen to susceptible crops.

The aster leafhopper, Macrosteles quadrilineatus Forbes, is an important pest of fresh market vegetable crops as the primary vector of the aster yellows (AY) phytoplasma. Two sampling methods, sticky trapping and inverted cage trapping, were used to monitor male and female leafhopper populations over three growing seasons in leaf lettuce fields in Ohio. Captures by one sampling method could not be used to estimate captures by the other method, because sticky traps captured significantly more male leafhoppers and cage traps captured significantly more females. The proportion of females collected in cage traps decreased significantly in individual plantings as lettuce matured and also over the course of the season in one of 2 yr of sampling by using both techniques. Subsamples of captured leafhoppers were tested for AY phytoplasma infection by using a polymerase chain reaction (PCR) assay. In one year of our study, more male than female leafhoppers were infected with AY phytoplasma. Because the field distribution of insect-vectored diseases can reveal information about vector movement, as well as vector identity, spatial analysis was performed. Analyses indicated the distribution of symptomatic AY phytoplasma-infected lettuce plants was significantly clustered and followed a beta-binomial distribution. Our data suggest that females may be responsible for at least the early season inoculation of clustered symptomatic lettuce plants.

Phytoplasmas are obligate symbionts of plants and insects that are responsible for significant yield losses in diverse crops. Genome sequencing has revealed that many phytoplasma genomes appear to contain repeated genes organized in units of approximately 20 kb. These 'potential mobile units' (PMUs) resemble composite replicative transposons. PMUs contain several genes for recombination and some also contain putative 'virulence genes'. Genome alignments suggest that PMUs are involved in phytoplasma genome instability and recombination. In this edition of Molecular Microbiology, Hogenhout and colleagues report that one PMU from the aster yellows phytoplasma strain Witches' Broom (AY-WB) can exist as both a linear PMU within the chromosome and as an extrachromosomal circular form. The copy number of the circular form is much higher in the insect vector compared with the plant, and expression levels of genes present on the PMU are also higher in the insect. These observations suggest not only that this PMU could be a mobile element, but that it could also be involved in a phase-variation mechanism that allows the phytoplasma to adapt to its different hosts.

Root wilt disease of coconut and grassy shoot diseases of sugarcane are diseases associated with phytoplasmas of the 16SrXI group. The present study aimed at characterizing and comparing the potC gene of the coconut root wilt (RWD) and sugarcane grassy shoot (SCGS) phytoplasmas with that of aster yellows (AY) phytoplasma. We isolated the full length potC gene of ATP-Binding Cassette (ABC) transport system from RWD, SCGS, AY phytoplasmas and a partial gene segment of Brinjal little leaf (BLL) phytoplasma using PCR. The full length potC gene, partial sequence of potB and potD genes were sequenced and characterized. Comparative molecular analysis of the potC gene from RWD, SCGS showed that both sequences had 99% nucleotide identity with each other and 70% with AY phytoplasma. Phylogenetic analysis revealed that the potC gene of coconut and sugarcane phytoplasmas clustered together and that AY phytoplasma clustered with 16SrI group phytoplasmas. The phylogeny of potC genes followed the 16S rRNA-based taxonomic classification of phytoplasmas so that it can be considered as a potential candidate for phylogenetic studies. Bioinformatics analysis of putative PotC proteins revealed that phytoplasmas have conserved motifs which are absent in other bacteria. However, the PotC proteins of phytoplasma and bacteria have one common domain (ABC transporter intergral membrane type-1 domain) and six transmembrane helices.

The almond, a commercially important tree nut crop worldwide, is native to the Mediterranean region. Stone fruit trees are affected by at least 14 'Candidatus Phytoplasma' species globally, among which 'Candidatus Phytoplasma asteris' is one of the most widespread phytoplasma infecting Prunus dulcis, causing aster yellows disease. Recently, almond plantations of Nauni region were consistently affected by phytoplasma, as evidenced by visible symptoms, fluorescent microscopic studies and molecular characterization. During several surveys from May to September 2020-2022, almond aster yellows phytoplasma disease showing symptoms such as chlorosis, inward rolling, reddening, scorching and decline with an incidence as high as 40%. Leaf samples were collected from symptomatic almond trees and the presence of phytoplasma was confirmed through fluorescent microscopic studies by employing DAPI (4, 6-diamino-2-phenylindole) that showed distinctive light blue flourescent phytoplasma bodies in phloem sieve tube elements. The presence of phytoplasma in symptomatic almond trees was further confirmed using nested PCR with specific primer pairs followed by amplification of 16S rDNA and 16S-23S rDNA intergenic spacer (IS) fragments. Sequencing and BLAST analysis of expected amplicon of the 16S rDNA gene confirmed that the almond phytoplasma in Himachal Pradesh was identical to the aster yellows group phytoplasma. Phylogenetic analysis of 16S rDNA almond phytoplasma also grouped 'Prunus dulcis' aster yellows phytoplasma within 16SrI-B subgroup showed 94% nucleotide identity with 'Prunus dulcis' phytoplasma PAEs3 and 'Prunus dulcis' phytoplasma PAE28 from Iran. This research presents the first host report of 'Candidatus Phytoplasma asteris' infecting almonds in India, expanding the knowledge of the diversity and distribution of phytoplasma strains affecting almond trees globally.