Antimicrobial Peptide Moricin Inhibits Streptococcus pneumoniae Growth Through Membrane Disruption: Insights From In Silico and InVitro Studies.
The rise of multidrug-resistant Streptococcus pneumoniae poses a major public health threat, necessitating novel therapeutic targets. Pneumococcal Surface Adhesin A (PsaA), a conserved surface lipoprotein, plays a key role in manganese acquisition, colonization and virulence. Immunization with PsaA elicits protective immunity, while fragment-based drug design has identified inhibitors disrupting its function. PsaA emerges as a promising molecular target for innovative therapeutic strategies against pneumococcal diseases. Antimicrobial peptides (AMPs) are crucial components of the innate immune system, providing a potent defence mechanism against a broad spectrum of pathogens. Moricin, an AMP initially identified in Bombyx mori, exhibits robust antimicrobial activity against Gram-positive bacteria. This study explores the inhibitory effects of moricin on S. pneumoniae, a significant human pathogen responsible for severe infections such as pneumonia, meningitis and sepsis. In silico analyses, including molecular docking and molecular dynamics simulations, revealed a strong interaction between moricin and the PsaA. Invitro studies corroborated the computational findings, demonstrating a dose-dependent inhibition of S. pneumoniae growth. Moricin induced bacterial membrane disruption, evidenced by increased membrane permeability, release of intracellular contents and altered membrane potential, highlighting the bactericidal mode of action. Furthermore, time-kill kinetics revealed rapid bacterial eradication, underscoring moricin's efficacy. Additionally, toxicity assays on the macrophage BV2 cell line demonstrated that moricin caused no significant structural or organelle damage, emphasizing its biocompatibility and safety. The integration of in silico and invitro approaches provides comprehensive mechanistic insights into moricin's antimicrobial action and establishes its potential as a safe and effective therapeutic agent against S. pneumoniae.
- Research Article
- 10.1007/s00232-025-00363-2
- Oct 18, 2025
- The Journal of membrane biology
Insect venom-derived antimicrobial peptides (AMPs) hold significant therapeutic promise, but their application is constrained by mammalian cell toxicity. Toxicity assays are rapid and high-throughput, but screening large peptide libraries remains resource-intensive due to the requirements for peptide synthesis, purification, and testing. Alternatively, molecular dynamics (MD) simulations using mammalian membrane models provide an efficient and robust method for preliminary toxicity prediction. To benchmark the optimal model, two distinct mammalian membrane systems with diverse lipid compositions were evaluated for a set of sixteen toxic and fourteen non-toxic AMP analogs from five distinct insect AMP families, viz. anoplin, polybia, halictine, hyline, and macropin. In this study, a total of 25µs of MD simulation time was generated. The analysis of MD trajectories, each spanning 500ns for each of the 30 peptides, revealed significant variations in structural stability and membrane permeability between toxic and non-toxic AMPs, which aligned with the experimental results. Root Mean Square Deviation (RMSD) of the peptides during the last 100ns of the simulation period successfully distinguished toxic from non-toxic AMPs with 90% accuracy when using realistic membrane models. The well-cited multicomponent mammalian membrane model failed to effectively predict mammalian toxicity. These findings underscore the efficacy of MD simulations in predicting the toxicity of venom-derived AMPs, thereby opening avenues for the accelerated development of safer antimicrobialtherapies.
- Research Article
- 10.6092/unina/fedoa/8713
- Nov 29, 2011
The Gram-positive pathogen Streptococcus pneumoniae is a major cause of community acquired pneumonia as well as of upper respiratory tract infections such as acute otitis media and sinusitis, and invasive diseases like meningitis, bacteremia, and endocarditis. However, S. pneumoniae is also a commensal of the upper respiratory tract, especially of young children, which represent the reservoir for pneumococcal transmission within the community. A major virulence factor of Streptococcus pneumoniae is the polysaccharide capsule. The pneumococcal capsule displays an extremely high variability (it exists in fact in at least ninety different types, known as serotypes) and provides an effective barrier against host-cell mediated phagocytosis allowing bacterial persistence in the blood. In addition to the capsular determinant, many other secreted or surface exposed factors have been described to be of importance for virulence through in vivo animal model studies and in vitro experiments (i.e. choline-binding protein A (CbpA), the pneumococcal toxin pneumolysin, pneumococcal surface protein A (PspA), pneumococcal surface adhesin A (PsaA), pilus components; however, their direct contribution to and essentiality for disease development in humans have still to be determined. Streptococcus pneumoniae pilus islet-1 (PI-1)-encoded pilus enhances in vitro adhesion to the respiratory epithelium and may contribute to pneumococcal nasopharyngeal colonization and transmission. The pilus subunits are regarded as potential protein vaccine candidates. In the first part of this study, we sought to determine PI-1 prevalence in carried pneumococcal isolates and explore its relationship with transmissibility or carriage duration. We studied 896 pneumococcal isolates collected during a longitudinal carriage study that included monthly nasopharyngeal swabbing of 234 infants and their mothers between the ages of 1 and 24 months. These were cultured according to the WHO pneumococcal carriage detection protocol. PI-1 PCR and genotyping by multilocus sequence typing were performed on isolates chosen according to specific carriage and transmission definitions. Overall, 35.2% of the isolates were PI-1-positive, but PI-1 presence was restricted to ten of the 34 serotypes studied and was most frequently associated with serotypes 19F and 23F; 47.5% of transmitted and 43.3% of non-transmitted isolates were PI-1-positive (OR 1.2; 95% CI 0.8–1.7; p 0.4). The duration of first-ever infant pneumococcal carriage was significantly longer with PI-1-positive organisms, but this difference was not significant at the individual serotype level. In conclusion, PI-1 is commonly found in pneumococcal carriage isolates, but does not appear to be associated with pneumococcal transmissibility or carriage duration. In the second part of this work, we focused on non-typeable Streptococcus pneumoniae (NTPn). NTPns are typically isolated from nasopharyngeal carriage or from conjunctivitis. Since the isolation of NTPn from invasive disease is rare, we characterized the genetic basis for non-typeability of two isolates obtained in Italy from two cases of bacteremic pneumonia. Multi Locus Sequence Typing (MLST) revealed that both NTPn belonged to ST191, which, according to the MLST database, is associated with serotype 7F. Sequencing of the capsular locus (cps) confirmed the presence of a 7F cps in both strains and revealed the existence of distinct single point mutations in the wchA gene (a glycosyltransferase), both leading to the translation of proteins truncated at the C-terminus. To verify if these mutations were responsible for non-typeability of the isolates, a functional 7F WchA was over-expressed in both NTPn. The two NTPn along with their WchA over-expressing derivatives were analyzed by Transmission Electron Microscopy and by high-resolution magic angle spinning NMR spectroscopy. Both NTPn were devoid of a polysaccharide capsule and WchA over-expression was sufficient to restore the assembly of a serotype 7F capsule on the surface of the two NTPn. In conclusion, we identified two new naturally-occurring point-mutations leading to the non typeability in pneumococcus and demonstrated that WchA is essential for the biosynthesis of the serotype 7F capsule.
- Supplementary Content
71
- 10.3390/antibiotics12030628
- Mar 22, 2023
- Antibiotics
The necessity for the discovery of innovative antimicrobials to treat life-threatening diseases has increased as multidrug-resistant bacteria has spread. Due to antibiotics’ availability over the counter in many nations, antibiotic resistance is linked to overuse, abuse, and misuse of these drugs. The World Health Organization (WHO) recognized 12 families of bacteria that present the greatest harm to human health, where options of antibiotic therapy are extremely limited. Therefore, this paper reviews possible new ways for the development of novel classes of antibiotics for which there is no pre-existing resistance in human bacterial pathogens. By utilizing research and technology such as nanotechnology and computational methods (such as in silico and Fragment-based drug design (FBDD)), there has been an improvement in antimicrobial actions and selectivity with target sites. Moreover, there are antibiotic alternatives, such as antimicrobial peptides, essential oils, anti-Quorum sensing agents, darobactins, vitamin B6, bacteriophages, odilorhabdins, 18β-glycyrrhetinic acid, and cannabinoids. Additionally, drug repurposing (such as with ticagrelor, mitomycin C, auranofin, pentamidine, and zidovudine) and synthesis of novel antibacterial agents (including lactones, piperidinol, sugar-based bactericides, isoxazole, carbazole, pyrimidine, and pyrazole derivatives) represent novel approaches to treating infectious diseases. Nonetheless, prodrugs (e.g., siderophores) have recently shown to be an excellent platform to design a new generation of antimicrobial agents with better efficacy against multidrug-resistant bacteria. Ultimately, to combat resistant bacteria and to stop the spread of resistant illnesses, regulations and public education regarding the use of antibiotics in hospitals and the agricultural sector should be combined with research and technological advancements.
- Research Article
12
- 10.3389/fphar.2021.731499
- Oct 7, 2021
- Frontiers in Pharmacology
Background/Aim: Host defense peptides (HDPs) have the potential to provide a novel solution to antimicrobial resistance (AMR) in view of their unique and broad-spectrum antimicrobial activities. We had recently developed a novel hybrid HDP based on LL-37 and human beta-defensin-2, named CaD23, which was shown to exhibit good in vivo antimicrobial efficacy against Staphylococcus aureus in a bacterial keratitis murine model. This study aimed to examine the potential CaD23-antibiotic synergism and the secondary structure and underlying mechanism of action of CaD23. Methods: Peptide-antibiotic interaction was evaluated against S. aureus, methicillin-resistant S. aureus (MRSA), and Pseudomonas aeruginosa using established checkerboard and time-kill assays. Fractional inhibitory concentration index (FICI) was calculated and interpreted as synergistic (FIC<0.5), additive (FIC between 0.5–1.0), indifferent (FIC between >1.0 and ≤4), or antagonistic (FIC>4). SYTOX green uptake assay was performed to determine the membrane-permeabilising action of CaD23. Molecular dynamics (MD) simulations were performed to evaluate the interaction of CaD23 with bacterial and mammalian mimetic membranes. Circular dichroism (CD) spectroscopy was also performed to examine the secondary structures of CaD23. Results: CaD23-amikacin and CaD23-levofloxacin combination treatment exhibited a strong additive effect against S. aureus SH1000 (FICI = 0.60–0.69) and MRSA43300 (FICI = 0.56–0.60) but an indifferent effect against P. aeruginosa (FIC = 1.03–1.15). CaD23 (at 25 μg/ml; 2xMIC) completely killed S. aureus within 30 min. When used at sub-MIC concentration (3.1 μg/ml; 0.25xMIC), it was able to expedite the antimicrobial action of amikacin against S. aureus by 50%. The rapid antimicrobial action of CaD23 was attributed to the underlying membrane-permeabilising mechanism of action, evidenced by the SYTOX green uptake assay and MD simulations studies. MD simulations revealed that cationicity, alpha-helicity, amphiphilicity and hydrophobicity (related to the Trp residue at C-terminal) play important roles in the antimicrobial action of CaD23. The secondary structures of CaD23 observed in MD simulations were validated by CD spectroscopy. Conclusion: CaD23 is a novel alpha-helical, membrane-active synthetic HDP that can enhance and expedite the antimicrobial action of antibiotics against Gram-positive bacteria when used in combination. MD simulations serves as a powerful tool in revealing the peptide secondary structure, dissecting the mechanism of action, and guiding the design and optimisation of HDPs.
- Research Article
23
- 10.3390/ijms25073835
- Mar 29, 2024
- International Journal of Molecular Sciences
Antimicrobial peptides (AMPs), as immune effectors synthesized by a variety of organisms, not only constitute a robust defense mechanism against a broad spectrum of pathogens in the host but also show promising applications as effective antimicrobial agents. Notably, insects are significant reservoirs of natural AMPs. However, the complex array of variations in types, quantities, antimicrobial activities, and production pathways of AMPs, as well as evolution of AMPs across insect species, presents a significant challenge for immunity system understanding and AMP applications. This review covers insect AMP discoveries, classification, common properties, and mechanisms of action. Additionally, the types, quantities, and activities of immune-related AMPs in each model insect are also summarized. We conducted the first comprehensive investigation into the diversity, distribution, and evolution of 20 types of AMPs in model insects, employing phylogenetic analysis to describe their evolutionary relationships and shed light on conserved and distinctive AMP families. Furthermore, we summarize the regulatory pathways of AMP production through classical signaling pathways and additional pathways associated with Nitric Oxide, insulin-like signaling, and hormones. This review advances our understanding of AMPs as guardians in insect immunity systems and unlocks a gateway to insect AMP resources, facilitating the use of AMPs to address food safety concerns.
- Book Chapter
3
- 10.1079/9781845932886.0301
- Jan 1, 2007
Commercial production of crop plants is often threatened by recurring bacterial, fungal and viral infections. Pesticides and insecticides have commonly been used to contain phytopathogens but their extensive use has contributed to chemical contamination of the environment. Genetic engineering is an effective strategy for developing disease-resistant germplasm that increases yield, reduces loss, and eliminates or reduces the use of pesticides. Antimicrobial peptides are important components of innate disease immunity and have been isolated from a wide variety of organisms. These widespread natural products vary greatly in their properties and spectrum of biological activities. Different peptides and their synthetic derivatives have found applications as antibacterial, antifungal and therapeutic agents. Attempts have been made to bolster plant defences against microorganisms by genetically engineering plants to express cationic peptides. Because the primary target of the cationic peptides is the cell membrane and not a specific receptor or substrate, these peptides confer their activities against a broad spectrum of pathogens and there is only a low probability of resistance arising by changes to metabolic pathways. This chapter highlights salient features of antimicrobial peptides and their applications in plant biotechnology for management of a broad spectrum of diseases.
- Research Article
- 10.1096/fasebj.29.1_supplement.lb477
- Apr 1, 2015
- The FASEB Journal
Streptococcus pneumoniae is a leading cause of pneumococcal infections, especially in young children in developing countries. Treatment relies heavily on β‐lactam antibiotics, however, rapid emergence of multidrug‐resistant strains of S. pneumoniae over the past two decades has shifted the focus towards identification of novel drug targets. Pneumococcal surface adhesin A (PsaA) is one such drug target, found on the cell surface of S. pneumoniae. It functions as surface adhesin, as well as substrate binding protein, facilitating acquisition of Mn2+, an essential cation that plays an important role in protecting S. pneumoniae from reactive oxygen species produced during oxidative stress. PsaA is essential for bacterial survival and is an important virulence factor, rendering it a promising target for antibiotic development.To design novel PsaA inhibitors, we used a combination of de novo fragment‐based drug discovery (FBDD) and in silico virtual screening methods. We profiled a collection of low molecular weight compounds that were selected based on their structural diversity and ability to bind to apo‐PsaA in a virtual docking experiment. The screening resulted in two initial hits that were further optimized by structural variation to improve their potency while maintaining their ligand‐efficiency and physicochemical properties. The optimized hits were validated using cell‐based assay and molecular dynamics simulations. We found that virtual screening substantially augmented FBDD approaches, leading to the identification of novel PsaA inhibitors.
- Research Article
23
- 10.2217/fmb.15.45
- Jun 29, 2015
- Future Microbiology
Antimicrobial peptides: has their time arrived?
- Research Article
1
- 10.7324/jabb.2025.210174
- Jan 1, 2024
- Journal of Applied Biology & Biotechnology
Antibiotics have long been the foundation stone of combating infectious diseases, but the widespread and often indiscriminate use of these drugs has given rise to drug-resistant pathogens, presenting a global health crisis. There is an urgent need to explore alternative therapeutic strategies that are less susceptible to resistance mechanisms as traditional antibiotics are losing their efficiency. Antimicrobial peptides (AMPs), small bioactive proteins naturally produced by a wide range of organisms, have emerged as promising candidates in the search for new antibiotics. AMPs serve as the first line of defense against a broad spectrum of pathogens, including bacteria, viruses, and fungi. This review article looks into the wide potential of AMPs, not only as antibacterial agents but also in their roles as antifungal, antiviral, and anticancer therapies. The present review article provides an in-depth exploration of the structural diversity of AMPs, examining how their unique properties contribute to their broad-spectrum activity. It further discusses the mechanisms and modes of action that differentiate AMPs from conventional antibiotics. Despite their immense potential, several challenges such as toxicity, stability, and high production costs hinder the clinical application of AMPs. This article not only outlines these challenges but also discusses emerging strategies aimed at overcoming these barriers. Overall the review presents AMPs as a critical focus in the development of future antimicrobial therapies.
- Research Article
9
- 10.3390/microorganisms8050626
- Apr 25, 2020
- Microorganisms
The spread of multidrug-resistant Gram-negative bacteria is an increasing threat to human health, because novel compound classes for the development of antibiotics have not been discovered for decades. Antimicrobial peptides (AMPs) may provide a much-needed breakthrough because these immunity-related defense molecules protect many eukaryotes against Gram-negative pathogens. Recent concepts in evolutionary immunology predict the presence of potent AMPs in insects that have adapted to survive in habitats with extreme microbial contamination. For example, the saprophagous and coprophagous maggots of the drone fly Eristalis tenax (Diptera) can flourish in polluted aquatic habitats, such as sewage tanks and farmyard liquid manure storage pits. We used next-generation sequencing to screen the E. tenax immunity-related transcriptome for AMPs that are synthesized in response to the injection of bacterial lipopolysaccharide. We identified 22 AMPs and selected nine for larger-scale synthesis to test their activity against a broad spectrum of pathogens, including multidrug-resistant Gram-negative bacteria. Two cecropin-like peptides (EtCec1-a and EtCec2-a) and a diptericin-like peptide (EtDip) displayed strong activity against the pathogens, even under simulated physiological conditions, and also achieved a good therapeutic window. Therefore, these AMPs could be used as leads for the development of novel antibiotics.
- Research Article
1
- 10.1038/s41598-025-21223-y
- Oct 27, 2025
- Scientific Reports
Antimicrobial peptides (AMPs) are essential components of the innate immune system in humans and other organisms, exhibiting potent activity against a broad spectrum of pathogens. Their potential therapeutic applications, particularly in combating antibiotic resistance, have rendered AMP classification a vital task in computational biology. However, the scarcity of labeled AMP sequences, coupled with the diversity and complexity of AMPs, poses significant challenges for the training of standalone AMP classifiers. Self-supervised learning has emerged as a powerful paradigm in addressing such challenges across various fields, leading to the development of Protein Language Models (PLMs). These models leverage vast amounts of unlabeled protein sequences to learn biologically relevant features, providing transferable protein sequence representations (embeddings), that can be fine-tuned for downstream tasks even with limited labeled data. This study evaluates the performance of several publicly-available PLMs in AMP classification utilizing transfer learning techniques and benchmarking them against state-of-the-art neural-based classifiers. Our key findings include: (a) Model scale is crucial, with classification performance consistently improving with increasing model size; (b) State-of-the-art results are achieved with minimal effort utilizing PLM embedding representations alongside shallow classifiers; and (c) Classification performance is further enhanced through efficient fine-tuning of PLMs’ parameters. Code showcasing our pipelines is available at https://github.com/EliasGeorg/PLM_AMP_Classification.
- Discussion
1
- 10.4103/0971-5916.184307
- Jan 1, 2016
- Indian Journal of Medical Research
Sir, Despite variable levels of antibiotic resistance in clinical isolates of Streptococcus pneumoniae reported from India, invasive pneumococcal infection continues to pose a challenge in children1. It is a paradox that the susceptibility of pneumococci to antibiotics is not as major a problem as it is observed with staphylococci, enterococci and the Gram-negative bacteria, though outcome of some of the pneumococcal infections are fatal2. Rapidly progressive disease in the vulnerable population namely, the very young and the elderly is a challenge to the treating physician, a factor which is compounded by lack of confirmatory diagnosis due to poor laboratory support. Sporadic reports of adult pneumococcal infections have been documented3. Factors predisposing this group to fatal pneumococcal infection are unknown4. Vaccination of the adult population is limited to the very elderly and those with risk of underlying immunosuppression and splenectomized persons5. We encountered two cases of invasive pneumococcal infections in adult patients with progressive illness with a fatal outcome in a tertiary care centre in south India during 2012. An attempt was made to detect virulence genes coding for pneumolysin (ply) and autolysin (lytA), as these two antigens are known to be associated with virulence of S. pneumoniae in experimental animals6. The first case was a 72 years old male with loss of consciousness for 12 h, brought to the emergency unit of Pondicherry Institute of Medical Sciences, Puducherry, India. He had no history of fever, breathlessness or seizures. He did not have any known risk factors. At admission he had respiratory distress and was transferred to the intensive care unit (ICU) for intubation. Chest X- ray showed bilateral infiltrates with pneumothorax on the left side. Computed tomography (CT) of the brain revealed dilated ventricles. Initial laboratory investigations revealed the following values: total WBC count of 9800/mm3, differential count of 89 per cent neutrophils, 8 per cent lymphocytes and 3 per cent monocytes. A preliminary diagnosis of sepsis with pneumonia and pyogenic meningitis was made. He was started empirically on cefoperazone sulbactam, metronidazole and doxycycline (due to the area being endemic for scrub typhus). Subsequently, blood and CSF cultures grew S. pneumoniae (IBT 1960) (serotyped as 33C- Pneumotest- Statens Serum Institute, Solna, Sweden), which was susceptible to ampicillin, penicillin (by oxacillin screen), ceftriaxone, cefotaxime and vancomycin. Following the culture report antibiotics were changed to vancomycin and ampicillin. He developed hypotension and shock, and despite ventilatory support, administration of intravenous fluids, antibiotics and vassopressor agents his condition deteriorated and he died within 48 h of admission. The second case was a 47 year old male who was conscious but restless and disoriented, and was brought to the casualty of this hospital. There was history of fever and shortness of breath for two weeks, cough for one week and chest pain for two days. There was no other co-morbid condition. Chest X-ray revealed right lower lobe consolidation. Complete blood count revealed total WBC count to be 24000/mm3 and a differential count suggestive of pyogenic infection (95% neutrophils, 4% lymphocytes, 1% monocytes). A diagnosis of right lower lobe pneumonia associated with acute respiratory distress syndrome, sepsis and multi-organ dysfunctional syndrome was made. He was empirically started on linezolid, imipenem and piperacillin-tazobactam. Sepsis was confirmed by a positive blood culture for S. pneumoniae (IBT -1975; serotype 7C), which was sensitive to penicillin, ciprofloxacin, ceftriaxone, erythromycin, gentamicin and vancomycin. The patient was continued with linezolid, imipenem while azithromycin was added. His condition continued to deteriorate and he succumbed to the infection within 72 h of admission. The two isolates were further tested for the presence of different virulence determinants such as genes encoding for pneumolysin (ply), autolysin (lytA) and to document presence of virulence factors and penicillin binding protein (pbpA)7. The primer details are given below: lytA (size 319 bp)4 forward primer F-5’AACCGTACAGAATGAAGCGG-3’ and reverse primer R-5’ TATTCGTGCAATACTCGTGCG-3’; ply (size 348 bp) forward primer F- 5’ATTTCTGTAACAGCTACCAACGA3’ and reverse primer R- 5’GAATTCCCTGTCTTTTCAAAGTC3’; pbpA (size-789 bp) forward primer F-5’CCGTATCCTGGGAGCTTTCTT-3’ and reverse primer R-5’-TCGCGGTTTGTTTCTACTGC-3’. All primers used in the study were designed using GeneTool software and custom synthesize by Eurofins (Bengaluru, India), used in previously described study7. All three genes were detected in both the isolates (Figure). Figure Pneumolysin (ply), autolysin (lytA) and modified penicillin binding protein (pbpA) genes amplified in the two isolates from cases of fatal pneumococcal infection. Amplicon sizes: ply - 348 bp; lytA - 319 bp and pbpA - 789 bp. M - 100 bp ladder (Gene ruler); ... Rapidly fatal pneumococcal disease is known to occur in immunocompromised individuals, splenectomized individuals and HIV infected patients are at increased risk of developing severe pneumococcal disease8,9. Fatal outcome in the immunocompetent patients have been infrequently reported in literature10. Rapidly progressing pneumococcal sepsis with metabolic acidosis and disseminated intravascular coagulation has been reported in two adult individuals by Iinuma et al3. Analysis of the isolates revealed two interesting observations. Both the isolates that were responsible for fatal outcome belonged to non-vaccine serotypes i.e. 33C and 7C. The capsular polysaccharide-23 valent vaccine used for adult vaccination does not contain these two serotypes11,12. Studies in the West have shown that infections due to vaccine serotypes have declined in adults following vaccination of children with PCV-7 while non-vaccine serotypes causing invasive infections in high risk adults has risen13,14,15. In India, where pneumococcal vaccines have not been included in the routine immunization schedule in children, and adult vaccination is sporadic, and serotyping of invasive isolates remains a challenge. Routine typing to know the incidence of infections due to vaccine or non-vaccine serotypes both in children and adults, is not undertakn by most clinical laboratories across the country. Fatal infections caused by non-23 valent vaccine serotypes such as 33C and 7C of S. pneumoniae observed in this study raise the question on current strategies of adult pneumococcal vaccination. As the patients were healthy adults, preventive vaccination would not have played a role in protecting these individuals. Pathogenesis of invasive pneumococcal disease depends on both host inflammatory response as well as the organism's virulence. Several virulence factors have been incriminated in the pathogenesis of pneumococcal disease, including autolysin, pneumolysin (a key inducer of apoptosis) and pneumococcal surface adhesin A (PsaA)16. Capsular polysaccharide is the most commonly attributed factor. Pneumolysin is a cholesterol dependent cytolysin, that binds to cells and induces apoptosis17. Pneumolysin is known to reduce ciliary action, phagocytic function of polymorphonuclear cells and induce acute inflammatory reaction18. Both the isolates in this study were positive for genes coding for autolysin and pneumolysin. Though pbp gene was detected, penicillin resistance was not detected phenotypically, suggesting non-phenptypic expression of the gene. Our observation highlights two points. First, the involvement of non-vaccine serotypes in fatal invasive pneumococcal infection in adults. Some studies have shown a decline in adult pneumococcal disease following introduction of multi-valent pneumococcal conjugate vaccine in children13,18. But adult invasive infection and protecting the high risk groups still remains a major problem in several countries19. The US advisory committee on invasive pneumococcal disease (ACIP) has recommended the use of 23 valent polysaccharide vaccine (PPSV23) and the PCV13 (conjugate vaccine) for use in the elderly population aged >65 yr7,20. Secondly, could presence of pneumolysin and autolysin genes in the isolates obtained from these patients have any diagnostic or prognostic indications? Severity of pneumococcal pneumonia associated with bacterial genomic load determined by the copies of lytA genes has been reported21. In patients with no underlying risk factors, a strong suspicion of invasive pneumococcal disease with rapid assessment needs to be done to prevent grave outcome. A delay in treatment can occur in young and middle-aged patients, who are otherwise healthy leading to serious consequence. Accurate management in a timely manner can improve outcome. Rapid laboratory tests are essential for confirmatory diagnosis. A rapid diagnostic tool has been developed to detect pneumococcal antigen in urine and other body fluids which shows high sensitivity and specificity in adults19. The two isolates from our patients had the lytA and ply genes, although we did not attempt to detect this from the patients’ blood or body fluids. High level of clinical suscpicion with laboratory support by conventional blood culture, effective case management with appropriate antibiotics will decrease morbidity and mortality due to invasive pneumococcal disease in adults.
- Research Article
8
- 10.1080/07391102.2018.1484814
- Nov 13, 2018
- Journal of Biomolecular Structure and Dynamics
Current research has shown cell-penetrating peptides and antimicrobial peptides (AMPs) as probable vectors for use in drug delivery and as novel antibiotics. It has been reported that the higher the therapeutic index (TI) the higher would be the bacterial cell penetrating ability. To the best of our knowledge, no in-silico study has been performed to determine bacterial cell specificity of the antimicrobial cell penetrating peptides (aCPP’s) based on their TI. The aim of this study was to develop a quantitative structure activity relationship (QSAR) model, which can estimate antimicrobial potential and cell-penetrating ability of aCPPs against S. aureus, to confirm the relationship between the TI and aCPPs and to identify specific descriptors responsible for aCPPs penetrating ability. Molecular dynamics (MD) simulation was also performed to confirm the membrane insertion of the most active aCPPs obtained from the QSAR study. The most appropriate pharmacophore was identified to predict the aCPP’s activity. The statistical results confirmed the validity of the model. The QSAR model was successful in identifying the optimal aCPP with high activity prediction and provided insights into the structural requirements to correlate their TI to cell penetrating ability. MD simulation of the best aCPP with 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) bilayer confirmed its interaction with the membrane and the C-terminal residues of the aCPP played a key role in membrane penetration. The strategy of combining QSAR and molecular dynamics, allowed for optimal estimation of ligand-target interaction and confirmed the importance of Trp and Lys in interacting with the POPC bilayer.Communicated by Ramaswamy H. Sarma
- Research Article
68
- 10.1016/0003-9969(91)90142-h
- Jan 1, 1991
- Archives of Oral Biology
Antimicrobial proteins in human unstimulated whole saliva in relation to each other, and to measures of health status, dental plaque accumulation and composition
- Research Article
8
- 10.1016/j.bpj.2013.12.001
- Jan 1, 2014
- Biophysical Journal
Energetic View on Membrane Pore Formation
- Ask R Discovery
- Chat PDF
AI summaries and top papers from 250M+ research sources.