A novel homozygous PPP1R13L frameshift variant in a child with syndromic dilated cardiomyopathy and fatal arrhythmia.
Dilated cardiomyopathy is a rare but severe myocardial disease in the paediatric population, often leading to heart failure, heart transplantation, or sudden cardiac death. Genetic factors are a major contributor to childhood dilated cardiomyopathy. Recently, biallelic variants in the PPP1R13L gene have been implicated in a novel syndromic form of early-onset dilated cardiomyopathy, characterised by cardiac dysfunction alongside variable ectodermal features. We report a 4-year-old boy who presented with decompensated heart failure and echocardiographic findings consistent with dilated cardiomyopathy. Syndromic features included sparse, dry hair, high anterior hairline, broad nasal bridge, and pointed teeth. Genetic analysis revealed a novel homozygous frameshift variant in the PPP1R13L gene (c.2368_2375dup; p. Pro793Glyfs*32), classified as pathogenic. The clinical course was complicated by recurrent ventricular arrhythmias and ultimately sudden cardiac death. PPP1R13L-related cardiomyopathy should be considered in children with early-onset dilated cardiomyopathy and syndromic features. Early diagnosis is critical for clinical management, arrhythmia surveillance, and appropriate family counselling.
- Research Article
1
- 10.1016/j.rbmo.2025.104974
- Sep 1, 2025
- Reproductive biomedicine online
Novel homozygous variants in piRNA pathway factors lead to male infertility in humans.
- Research Article
3
- 10.1002/mgg3.2486
- Jun 1, 2024
- Molecular genetics & genomic medicine
Dilated cardiomyopathy (DCM) is characterized by dilatation of the left ventricle, systolic dysfunction, and normal or reduced thickness of the left ventricular wall. It is a leading cause of heart failure and cardiac death at a young age. Cases with neonatal onset DCM were correlated with severe clinical presentation and poor prognosis. A monogenic molecular etiology accounts for nearly half of cases. Here, we report a family with three deceased offspring at the age of 1 year old. The autopsy of the first deceased infant revealed a DCM. The second infant presented a DCM phenotype with a severely reduced Left Ventricular Ejection Fraction (LVEF) of 10%. Similarly, the third infant showed a severe DCM phenotype with LVEF of 30% as well, in addition to eccentric mitral insufficiency. Exome sequencing was performed for the trio (the second deceased infant and her parents). Data analysis following the autosomal dominant and recessive patterns of inheritance was carried out along with a mitochondrial pathways-based analysis. We identified a homozygous frameshift variant in the TNNI3 gene (c.204delG; p.(Arg69AlafsTer8)). This variant has been recently reported in the ClinVar database in association with cardiac phenotypes as pathogenic or likely pathogenic and classified as pathogenic according to ACMG. Genetic counseling was provided for the family and a prenatal diagnosis of choronic villus was proposed in the absence of pre-implantation genetic diagnosis possibilities. Our study expands the case series of early-onset DCM patients with a protein-truncating variant in the TNNI3 gene by reporting three affected infant siblings.
- Research Article
- 10.1186/s12920-026-02308-7
- Feb 4, 2026
- BMC Medical Genomics
Weill–Marchesani syndrome (WMS) is a rare connective tissue disorder. The main clinical features include short stature with a stocky build, brachydactyly, joint stiffness, and microspherophakia. The syndrome can be inherited in an autosomal dominant manner due to heterozygous pathogenic variants in FBN1, as well as in an autosomal recessive manner associated with biallelic pathogenic variants in ADAMTS10, ADAMTS17, or LTBP2. Despite differences in inheritance patterns, the clinical manifestations are consistent. Therefore, clinical diagnosis requires genetic testing of the proband to determine the genotype, confirm the diagnosis. This study collected blood samples from a child with Weill–Marchesani syndrome (WMS) and their family members from a Chinese family. Comprehensive ophthalmologic and systemic examinations were performed. Whole-exome sequencing (WES) was conducted to detect genetic variants, and bioinformatics tools were used to screen for potential pathogenic variants. Suspected variants were validated by Sanger sequencing and comprehensively evaluated in combination with clinical data. Using the keywords “ADAMTS10” and “Weill–Marchesani syndrome,” relevant cases were retrieved from databases such as PubMed, CNKI (China National Knowledge Infrastructure), and Wanfang Medical. The genotypes and clinical manifestations of reported cases were analyzed and summarized. The proband presented with clinical features including short stature, brachydactyly, and ocular abnormalities. Ocular manifestations included high myopia, microspherophakia, and glaucoma. Whole-exome sequencing revealed a homozygous frameshift duplication variant in the ADAMTS10: NM_030957.4:c.1560_1575dup; p.Ile526Valfs*51. Both phenotypically normal parents were heterozygous carriers of the same variant. According to the variant interpretation principles of the Human Gene Mutation Database (HGMD) and the guidelines of the American College of Medical Genetics and Genomics (ACMG), this variant was classified as pathogenic. A review of the literature indicated that WMS associated with ADAMTS10 variants exhibits complex and heterogeneous clinical phenotypes. A novel homozygous frameshift variant of ADAMTS10is identified in a WMS family with a history of consanguineous marriage. Our study expands the range of variations associated with WMS and deepens our understanding of pathology in disease associated with ADAMTS10 variants.
- Research Article
14
- 10.1038/s41431-022-01204-9
- Oct 17, 2022
- European Journal of Human Genetics
Autosomal dominant variants in LDB3 (also known as ZASP), encoding the PDZ-LIM domain-binding factor, have been linked to a late onset phenotype of cardiomyopathy and myofibrillar myopathy in humans. However, despite knockout mice displaying a much more severe phenotype with premature death, bi-allelic variants in LDB3 have not yet been reported. Here we identify biallelic loss-of-function variants in five unrelated cardiomyopathy families by next-generation sequencing. In the first family, we identified compound heterozygous LOF variants in LDB3 in a fetus with bilateral talipes and mild left cardiac ventricular enlargement. Ultra-structural examination revealed highly irregular Z-disc formation, and RNA analysis demonstrated little/no expression of LDB3 protein with a functional C-terminal LIM domain in muscle tissue from the affected fetus. In a second family, a homozygous LDB3 nonsense variant was identified in a young girl with severe early-onset dilated cardiomyopathy with left ventricular non-compaction; the same homozygous nonsense variant was identified in a third unrelated female infant with dilated cardiomyopathy. We further identified homozygous LDB3 frameshift variants in two unrelated probands diagnosed with cardiomegaly and severely reduced left ventricular ejection fraction. Our findings demonstrate that recessive LDB3 variants can lead to an early-onset severe human phenotype of cardiomyopathy and myopathy, reminiscent of the knockout mouse phenotype, and supporting a loss of function mechanism.
- Research Article
- 10.1016/j.ajhg.2026.01.017
- Mar 1, 2026
- American journal of human genetics
Bi-allelic variants in NRDC cause a neurodevelopmental disorder characterized by neonatal lethality, microcephaly, and brain abnormalities.
- Research Article
16
- 10.1002/ajmg.a.62699
- Feb 21, 2022
- American Journal of Medical Genetics Part A
Leiomodin-2 (LMOD2) is an important regulator of the thin filament length, known to promote elongation of actin through polymerization at pointed ends. Mice with Lmod2 deficiency die around 3 weeks of age due to severe dilated cardiomyopathy (DCM), resulting from decreased heart contractility due to shorter thin filaments. To date, there have been three infants from two families reported with biallelic variants in LMOD2, presenting with perinatal onset DCM. Here, we describe a third family with a child harboring a previously described homozygous frameshift variant, c.1243_1244delCT (p.L415Vfs*108) with DCM, presenting later in infancy at 9 months of age. Family history was relevant for a sibling who died suddenly at 1 year of age after being diagnosed with cardiomegaly. LMOD2-related cardiomyopathy is a rare form of inherited cardiomyopathy resulting from thin filament length dysregulation and should be considered in genetic evaluation of newborns and infants with suspected autosomal recessive inheritance or sporadic early onset cardiomyopathy.
- Research Article
29
- 10.1038/s41436-021-01097-x
- Jun 1, 2021
- Genetics in medicine : official journal of the American College of Medical Genetics
PurposeThe endoplasmic reticulum membrane complex (EMC) is a highly conserved, multifunctional 10-protein complex related to membrane protein biology. In seven families, we identified 13 individuals with highly overlapping phenotypes who harbor a single identical homozygous frameshift variant in EMC10. MethodsUsing exome, genome, and Sanger sequencing, a recurrent frameshift EMC10 variant was identified in affected individuals in an international cohort of consanguineous families. Multiple families were independently identified and connected via Matchmaker Exchange and internal databases. We assessed the effect of the frameshift variant on EMC10 RNA and protein expression and evaluated EMC10 expression in normal human brain tissue using immunohistochemistry. ResultsA homozygous variant EMC10 c.287delG (Refseq NM_206538.3, p.Gly96Alafs*9) segregated with affected individuals in each family, who exhibited a phenotypic spectrum of intellectual disability (ID) and global developmental delay (GDD), variable seizures and variable dysmorphic features (elongated face, curly hair, cubitus valgus, and arachnodactyly). The variant arose on two founder haplotypes and results in significantly reduced EMC10 RNA expression and an unstable truncated EMC10 protein. ConclusionWe propose that a homozygous loss-of-function variant in EMC10 causes a novel syndromic neurodevelopmental phenotype. Remarkably, the recurrent variant is likely the result of a hypermutable site and arose on distinct founder haplotypes.
- Research Article
- 10.1515/jpem-2025-0735
- Apr 7, 2026
- Journal of pediatric endocrinology & metabolism : JPEM
Alström syndrome (AS, OMIM #203800) is a rare autosomal recessive disorder caused by biallelic pathogenic variants in ALMS1, characterized by obesity, cardiomyopathy, retinal dystrophy, sensorineural hearing loss, and progressive hepatic and renal involvement. We report a pediatric case of AS complicated by growth hormone deficiency (GHD), focusing on the clinical course and potential metabolic effects of growth hormone (GH) replacement therapy. A 13-year-old girl with AS presented with severe dyslipidemia, including hypertriglyceridemia (727 mg/dL), elevated total cholesterol (251 mg/dL), and low high-density lipoprotein cholesterol (23 mg/dL), together with dilated cardiomyopathy. She was diagnosed with GHD at 3years of age, with a height of-3.6 SD. GH replacement therapy led to sustained improvement in linear growth, reaching-1.9 SD, and was associated with long-term maintenance of lipid parameters within the normal range. Whole-exome sequencing identified a previously unreported homozygous frameshift variant in ALMS1 (NM_001378454.1:c.5763del; p.(Phe1921Leufs*18)). This case suggests that GH replacement therapy may contribute to improved lipid metabolism in patients with AS complicated by GHD. In addition, it expands the mutational spectrum of ALMS1 and highlights the potential metabolic benefits of early endocrine intervention inAS.
- Research Article
4
- 10.1002/ajmg.a.63402
- Sep 12, 2023
- American journal of medical genetics. Part A
Childhood-onset cardiomyopathy is a genetically heterogeneous group of conditions with several genes implicated. Recently, biallelic loss-of-function variants in PPP1R13L have been reported in association with a syndromic form of dilated cardiomyopathy (DCM). In addition, affected children manifest skin and hair abnormalities, cleft lip and palate (CLP), and eye findings. Here, we delineate the condition further by describing the phenotype associated with a homozygous frameshift variant (p.Arg330 ProfsTer76) in PPP1R13L detected in two sibships in a consanguineous family with six affected children. The index case had DCM and wooly hair, two of his siblings had DCM and CLP while three cousins had, in addition, glaucoma. Global developmental delay was observed in one child. All the children, except one, died during early childhood. Whole exome sequencing and whole genome sequencing did not reveal any other plausible variant. We provide further evidence that implicates PPP1R13L in a variable syndromic form of severe childhood-onset DCM and suggests expanding the spectrum of this condition to include glaucoma. Given the variability of the phenotype associated with PPP1R13-related DCM, a thorough evaluation of each case is highly recommended even in the presence of an apparently isolated DCM.
- Research Article
11
- 10.1136/jmedgenet-2021-108027
- Nov 15, 2021
- Journal of Medical Genetics
The 100 000 Genomes Project (100KGP) is a UK-wide initiative that has a goal of using whole genome sequencing (WGS) to identify genetic causes of rare inherited diseases and embed...
- Research Article
10
- 10.3389/fgene.2021.743833
- Oct 8, 2021
- Frontiers in Genetics
Background: Contactin 2, encoded by CNTN2 on chromosome 1q32.1, is a neural-specific glycoprotein and plays important roles in neurodevelopment. A deleterious homozygous variant in the CNTN2 gene was previously reported to cause autosomal recessive cortical myoclonic tremor and epilepsy. Since then, there has been no further report confirming the association of CNTN2 and epilepsy. Here, we reported one new case, who presented with epilepsy, carrying a novel homozygous frameshift variant in CNTN2. The clinical and genetic features of the patient were reviewed. Case presentation: The male patient presented with preschool age-of-onset neurodevelopmental impairment and focal seizures of temporal origin, and responded to valproate. A trio-whole exome sequencing revealed a novel homozygous frameshift variant in CNTN2 (c.2873_c.2874delCT, p.Thr958Thrfs). The patient’s mother was a heterozygous carrier while his father was wild-type; they were both unaffected and non-consanguineous. Further study revealed that maternal uniparental disomy (1q32.1) unmasked the heterozygous variant of CNTN2 in the proband. Conclusions: This case enhanced the gene–disease relationship between CNTN2 and epilepsy, which will help to further understand this emerging disorder.
- Research Article
2
- 10.1007/s13258-017-0596-6
- Jul 25, 2017
- Genes & Genomics
Primary microcephaly (MCPH) is a rare developmental defect characterized by impaired cognitive functions, retarded neurodevelopment and reduced brain size. It is genetically heterogeneous and so far more than 17 genes associated with this disease have been identified. Primary microcephaly type 1 (MCPH1) gene encodes a protein called microcephalin, which is implicated in chromosome condensation and DNA damage induced cellular responses. It is suggested to play a role in neurogenesis and regulation of the size of the cerebral cortex. Whole exome sequencing revealed a novel, homozygous frameshift mutation (c.373_374delAA) in MCPH1 gene in exon 5 resulting in frameshift change from p.Lys125Glusfs*7. Our report presents the results of the simultaneous analysis of the trio exome data of both unaffected parents and their affected son. A homozygous frameshift variant in the MCPH1 gene was identified as a plausible candidate causal variant for the clinical phenotype in this family.
- Research Article
36
- 10.1136/jmedgenet-2021-107919
- Aug 4, 2021
- Journal of medical genetics
BackgroundOligoasthenoteratozoospermia is a typical feature of sperm malformations leading to male infertility. Only a few genes have been clearly identified as pathogenic genes of oligoasthenoteratozoospermia.Methods and resultsHere, we identified a...
- Research Article
- 10.70962/lasid2025abstract.50
- Dec 22, 2025
- Journal of Human Immunity
Introduction RFX5 encodes regulatory factor X 5, a transcription factor essential for MHC class II gene expression and proper antigen presentation. Homozygous mutations cause Bare Lymphocyte Syndrome type II (BLS II), a form of combined immunodeficiency with variable clinical severity. Case Presentation We report a 50-year-old female patient presenting with a syndromic combined immunodeficiency. Since childhood, she exhibited recurrent respiratory tract infections, persistent mucocutaneous candidiasis, and severe viral infections, including herpesvirus reactivations. Clinical features included proportionate short stature, facial dysmorphism (flattened midface, hypertelorism), and mild developmental delay. Immunological workup revealed hypogammaglobulinemia with low switched memory B cells, CD4+ lymphopenia, with decreased effector CD4+ cells and absent DR expression, reduced antigen-specific proliferative responses. Over an eight-year follow-up period, the patient received intravenous immunoglobulin replacement therapy, experiencing a fair quality of life. She presented with recurrent respiratory infections necessitating multiple hospitalizations, with Aspergillus flavus, Aspergillus fumigatus, and Nocardia cyriacigeorgica isolated from cultures. She developed an invasive vulvar squamous cell carcinoma. Due to the extensive nature of the lesion, the surgery was planned in two stages. Surgical treatment was incomplete due to her physical condition. The patient died due to septic shock. Genetic testing identified a homozygous frameshift variant in RFX5: c.857_858+19delAGGTAAGGAAGTCAGTGGCCC (p.Gln286fs), predicted to disrupt DNA binding and abolish MHC class II expression. Discussion This case illustrates a severe form of RFX5-related combined immunodeficiency with syndromic features, opportunistic infections, and malignancy, likely reflecting profound antigen presentation impairment. The development of early-onset cancer underscores the broader oncogenic risk associated with chronic immune dysregulation in MHC class II deficiency. Conclusion Homozygous RFX5 mutations should be considered in patients with combined immunodeficiency and syndromic features. MHC class II expression testing remains critical in the diagnostic approach to such patients. Early genetic diagnosis is critical for anticipatory management and considering different therapeutic options.
- Research Article
30
- 10.1007/s00439-020-02226-3
- Oct 13, 2020
- Human Genetics
We aimed to detect the causative gene in five unrelated families with recessive inheritance pattern neurological disorders involving the central nervous system, and the potential function of the NEMF gene in the central nervous system. Exome sequencing (ES) was applied to all families and linkage analysis was performed on family 1. A minigene assay was used to validate the splicing effect of the relevant discovered variants. Immunofluorescence (IF) experiment was performed to investigate the role of the causative gene in neuron development. The large consanguineous family confirms the phenotype-causative relationship with homozygous frameshift variant (NM_004713.6:c.2618del) as revealed by ES. Linkage analysis of the family showed a significant single-point LOD of 4.5 locus. Through collaboration in GeneMatcher, four additional unrelated families' likely pathogenic NEMF variants for a spectrum of central neurological disorders, two homozygous splice-site variants (NM_004713.6:c.574+1G>T and NM_004713.6:c.807-2A>C) and a homozygous frameshift variant (NM_004713.6: c.1234_1235insC) were subsequently identified and segregated with all affected individuals. We further revealed that knockdown (KD) of Nemf leads to impairment of axonal outgrowth and synapse development in cultured mouse primary cortical neurons. Our study demonstrates that disease-causing biallelic NEMF variants result in central nervous system impairment and other variable features. NEMF is an important player in mammalian neuron development.